Review



plko 1 scramble vector  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Addgene inc plko 1 scramble vector
    Plko 1 Scramble Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1060 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+shrna+scramble+vector/pm41702885-72-1-4?v=Addgene+inc
    Average 96 stars, based on 1060 article reviews
    plko 1 scramble vector - by Bioz Stars, 2026-07
    96/100 stars

    Images



    Similar Products

    plko 1 scramble vector  (Addgene inc)
    96
    Addgene inc plko 1 scramble vector
    Plko 1 Scramble Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+shrna+scramble+vector/pm41702885-72-1-4?v=Addgene+inc
    Average 96 stars, based on 1 article reviews
    plko 1 scramble vector - by Bioz Stars, 2026-07
    96/100 stars
    		  Buy from Supplier
    nontargeting scramble shrna sequence oligonucleotide gcgcgatagcgctaataattt  (Addgene inc)
    96
    Addgene inc nontargeting scramble shrna sequence oligonucleotide gcgcgatagcgctaataattt
    Nontargeting Scramble Shrna Sequence Oligonucleotide Gcgcgatagcgctaataattt, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+shrna+scramble+vector/pm41339559-650-18-29?v=Addgene+inc
    Average 96 stars, based on 1 article reviews
    nontargeting scramble shrna sequence oligonucleotide gcgcgatagcgctaataattt - by Bioz Stars, 2026-07
    96/100 stars
    		  Buy from Supplier
    plko 1 scrambled control shrna vector  (Addgene inc)
    93
    Addgene inc plko 1 scrambled control shrna vector
    Plko 1 Scrambled Control Shrna Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+shrna+scramble+vector/pm40921794-168-20-27?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    plko 1 scrambled control shrna vector - by Bioz Stars, 2026-07
    93/100 stars
    		  Buy from Supplier
    scramble shrna control vector  (Addgene inc)
    93
    Addgene inc scramble shrna control vector
    Scramble Shrna Control Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+shrna+scramble+vector/pmc12358835__pnas%2E2425621122%2Esapp-30-1-5?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    scramble shrna control vector - by Bioz Stars, 2026-07
    93/100 stars
    		  Buy from Supplier
    pgfp plko 1 plasmids  (OriGene)
    96
    OriGene pgfp plko 1 plasmids
    Pgfp Plko 1 Plasmids, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+shrna+scramble+vector/ppr0852086-123-20-29?v=OriGene
    Average 96 stars, based on 1 article reviews
    pgfp plko 1 plasmids - by Bioz Stars, 2026-07
    96/100 stars
    		  Buy from Supplier
    plko 1 puromycin lentiviral vector  (Addgene inc)
    96
    Addgene inc plko 1 puromycin lentiviral vector
    Plko 1 Puromycin Lentiviral Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+shrna+scramble+vector/pm38413797-194-27-31?v=Addgene+inc
    Average 96 stars, based on 1 article reviews
    plko 1 puromycin lentiviral vector - by Bioz Stars, 2026-07
    96/100 stars
    		  Buy from Supplier
    plko 1 vector scramble shrna  (Addgene inc)
    96
    Addgene inc plko 1 vector scramble shrna
    Plko 1 Vector Scramble Shrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+shrna+scramble+vector/pm37646174-291-1-11?v=Addgene+inc
    Average 96 stars, based on 1 article reviews
    plko 1 vector scramble shrna - by Bioz Stars, 2026-07
    96/100 stars
    		  Buy from Supplier

    Image Search Results